ARTICLE

Probiotics Increase Intramuscular Fat and Improve the Composition of Fatty Acids in Sunit Sheep through the Adenosine 5′-Monophosphate-Activated Protein Kinase (AMPK) Signaling Pathway

Yue Zhang1,2https://orcid.org/0000-0002-0189-9287, Duo Yao3https://orcid.org/0000-0002-9937-9182, Huan Huang1https://orcid.org/0000-0002-0804-9541, Min Zhang1,2https://orcid.org/0000-0002-2662-1142, Lina Sun1,2https://orcid.org/0000-0003-4450-5038, Lin Su1,2https://orcid.org/0000-0002-2094-2906, LiHua Zhao1,2https://orcid.org/0000-0002-3334-1755, Yueying Guo1,2https://orcid.org/0000-0002-0158-1850, Ye Jin1,2,*https://orcid.org/0000-0001-8960-879X
Author Information & Copyright
1College of Food Science and Engineering, Inner Mongolia Agricultural University, Hohhot 010018, China
2Integrative Research Base of Beef and Lamb Processing Technology, Ministry of Agriculture and Rural Affairs of the People’s Republic of China, Hohhot 010018, China
3Inner Mongolia Institute of Quality and Standardization, Hohhot 010070, China
*Corresponding author : Ye Jin, College of Food Science and Engineering, Inner Mongolia Agricultural University, Hohhot 010018, China, Tel: +86-471-436-2690, Fax: +86-471-436-2690, E-mail: jinyeyc@sohu.com

© Korean Society for Food Science of Animal Resources. This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Received: Apr 29, 2023 ; Revised: Jul 13, 2023 ; Accepted: Jul 17, 2023

Published Online: Sep 01, 2023

Abstract

This experiment aims to investigate the impact of probiotic feed on growth performance, carcass traits, plasma lipid biochemical parameters, intramuscular fat and triglyceride content, fatty acid composition, mRNA expression levels of genes related to lipid metabolism, and the activity of the enzyme in Sunit sheep. In this experiment, 12 of 96 randomly selected Sunit sheep were assigned to receive the basic diet or the basic diet supplemented with probiotics. The results showed that supplementation with probiotics significantly increased the loin eye area, and decreased plasma triglycerides and free fatty acids, increasing the content of intramuscular fat and triglycerides in the muscle and improving the composition of the fatty acids. The inclusion of probiotics in the diet reduced the expression of adenosine 5’-monophosphate-activated protein kinase alpha 2 (AMPKα2) mRNA and carnitine palmitoyltransferase 1B (CPT1B) mRNA, while increasing the expression of acetyl-CoA carboxylase alpha (ACCα) mRNA, sterol regulatory element-binding protein-1c (SREBP-1c) mRNA, fatty acid synthase mRNA, and stearoyl-CoA desaturase 1 mRNA. The results of this study indicate that supplementation with probiotics can regulate fat deposition and improves the composition of fatty acids in Sunit sheep through the signaling pathways AMPK-ACC-CPT1B and AMPK-SREBP-1c. This regulatory mechanism leads to an increase in intramuscular fat content, a restructuring of muscle composition of the fatty acids, and an enhancement of the nutritional value of meat. These findings contribute to a better understanding of the food science of animal resources and provide valuable references for the production of meat of higher nutritional value.

Keywords: probiotics; intramuscular fat; fatty acid composition; adenosine 5′-monophosphate-activated protein kinase (AMPK) signaling pathway

Introduction

Intramuscular fat (IMF) exists around muscle fibers embedded in connective tissue sheaths and is considered the final product of the fat deposition process. It is one of the primary indicators to evaluate muscle quality and positively influences quality traits of meat, including flavor, juiciness, and tenderness (Chikwanha et al., 2018; Pećina et al., 2018; Wang et al., 2020). In addition to the content of IMF in meat, the composition of those fatty acids has also received increasing attention due to its possible implications for human health. In most studies, there was a significant positive correlation between monounsaturated fatty acids (MUFAs) and IMF content, while a negative relationship existed between IMF and most polyunsaturated fatty acids (PUFAs; Razmaitė et al., 2020). There are different sources of fatty acids in the IMF, which are de novo synthesis by the animal body and direct intake of fatty acids from the diet (Bessa et al., 2015). As a meat-type sheep, the contribution of de novo synthesis to fat deposition is relatively small (Laliotis et al., 2010). Therefore, optimizing the deposition and composition of the IMF through sheep production and feeding strategies will provide new opportunities for mutton producers to enhance meat quality characteristics (Juárez et al., 2021).

The probiotics feed improves the digestive and absorption functions of the host animals and enhances their immunity by altering their intestinal microbiota, which has a positive impact on the host animals. Lactobacillus casei has been proven to possess cholesterol-lowering and immune-modulating effects, with beneficial effects on host health (Ayala-Monter et al., 2019; Wang et al., 2021). Lactobacillus plantarum has been confirmed to reduce lipid level, and improve the functionality of the gut microbiota (Bao et al., 2012; Li et al., 2020). The probiotic preparation (L. casei and L. plantarum) possess the ability to simultaneously reduce serum cholesterol levels and improve the fatty acid composition of meat and milk (Rabelo et al., 2016; Toral et al., 2018). Dev concluded that a compound L. casei preparation fed to sheep can increase body weight gain and strengthen immunity (Dev et al., 2021). After the mixed culture of Lactobacillus was fed to creole goats, tissues of the animals in the probiotics group exhibited an increase in MUFAs and PUFAs, including linoleic acid (C18:2), linolenic acid (C18:3), and cis-9, trans-11 conjugated linoleic acid (Taboada et al., 2022). Lamb in the prebiotic group had better antioxidant status and water-holding capacity, and the meat was a tenderer (Nie et al., 2022). From these perspectives, dietary probiotics seem to be a technical method to improve animal performance, fatty acid composition, and meat quality. However, the molecular regulatory mechanism by which probiotics feed affects the IMF content and fatty acid composition in Sunit sheep is unclear.

The adenosine 5′-monophosphate-activated protein kinase (AMPK) signaling pathway is a major metabolic pathway that regulates lipid decomposition and synthesis. On the one hand, when AMPK is activated, the cascade effect of the AMPK signaling pathway that regulates fat metabolism is activated. AMPK is phosphorylated to rapidly inhibit the activity of acetyl-CoA carboxylase (ACC), the expression of ACC is reduced, and the catalyzed malonyl-CoA by ACC is reduced [malonyl-CoA is the main component of de novo lipogenesis, and it is an inhibitor of Carnitine palmitoyltransferase 1 (CPT1; Fang et al., 2019; Ke et al., 2018)]. This cascade reaction controls the rate at which free fatty acids (FFAs) in the organism enter mitochondria for β-oxidation, suggesting a central role for the AMPK-ACC signaling pathway in the regulation of lipolysis and synthesis (Thomson and Winder, 2009; Zhang et al., 2021). On the other hand, as a downstream target gene for AMPK, the sterol regulatory element-binding protein-1c (SREBP-1c) is a transcription factor that regulates lipid homeostasis by controlling the synthesis of cholesterol, fatty acids, triglycerides (TG), and phospholipids (Ferré et al., 2021). AMPK can inhibit the activity of SREBP-1c by phosphorylation, and SREBP-1c can release the active fragment to bind to the SREBP-1c response element on its downstream target gene, fatty acid synthase (FASN), which theoretically regulates fatty acid metabolism (Fang et al., 2019; Tong et al., 2016; Yang et al., 2017). Based on this, we hypothesized that the AMPK signaling pathway is involved in the regulation of IMF and fatty acid composition in Sunit sheep by probiotics feed.

This study assumed that long-term supplementation with probiotics could affect the content of IMF and the composition of fatty acids of Sunit sheep through the AMPK signaling pathway is contribute to improving the nutritional value of meat. This study aimed to investigate whether probiotics feed can be an effective means of promoting IMF deposition in Sunit sheep and to further evaluate the role of the AMPK signaling pathway in this process, thus revealing possible potential mechanisms by which probiotics feed regulates IMF and fatty acid composition in Sunit sheep. This study provides new ideas and strategies for the application of probiotics in animal husbandry.

Materials and Methods

Experimental design and diets

Twelve male sheep of ninety-six three-month-old Sunit sheep of similar live weight were randomly selected and divided into two groups for two different dietary treatments, one without probiotics (CON) and the other with probiotics (PRO). The foundation diet provided by the CON group consisted of a mixture of hay and concentrate composed primarily of cornmeal, fed at a rate of 1.5% of the sheep’s body weight. The PRO group was provided with the same basic diet but with 1% probiotics added to the concentrate. All experimental diets met the nutritional requirements of the sheep (Table 1). All sheep were individually housed in separate pens equipped with feeders. They were fed twice daily at 8:00 and 17:00. All sheep had ad libitum access to feed. Throughout the entire experimental procedure, no dietary selectivity occurred, and no instances of refusal to consume forage and/or concentrate were observed. The probiotics used in this study were a mixture of equal parts L. casei HM-09 and L. plantarum HM-10, which were provided by Inner Mongolia Agricultural University (China), the Key Laboratory of Dairy Biotechnology and Engineering of the Ministry of Education. Both of these probiotic strains were identified by screening fermented mare’s milk from Inner Mongolia.

Table 1. Ingredients and chemical composition of the base diet (%, as-fed basis)
Item Diet1)
CON POR
Ingredient composition
 Corn 60.29 58.63
 Sunflower meal 17.86 18.42
 Soybean meal 13.45 13.40
 Rapeseed 4.65 4.80
 Limestone powder 1.00 1.00
 Calcium phosphate 0.50 0.50
 Probiotic 0.00 1.00
 Vitamin and mineral premix2) 1.50 1.50
 NaCl 0.75 0.75
 Total 100.00 100.00
Chemical composition
 Crude protein 17.86 17.85
 Crude fat 3.66 3.65
 Crude fiber 10.60 10.54
 Crude ash 7.80 7.79
 Calcium 1.21 1.23
 Total phosphorus 0.63 0.65
 Lysine 0.35 0.33

1) CON, basic diet; POR, basic diet+1% probiotic.

2) Vitamin and mineral premix provided the following per kg of diet: 20,000 IU of vitamin A; 4,000 IU of vitamin D3; 80 IU of vitamin E; 16 mg of vitamin K; 2.5 mg of vitamin B1; 2.5 mg of vitamin B2; 8 mg of vitamin B6; 3.4 mg of vitamin B12; 54 mg of Ca-pantothenate; 25 mg of Cu; 36 mg of Zn; 58 mg of Mn; 0.5 mg of I; 0.3 mg of Co; 0.4 mg of Se.

Download Excel Table

All sheep were raised in a well-ventilated farmhouse with the same environmental conditions in Bayan Nur City, Inner Mongolia Autonomous Region, China. The light was provided naturally. The sheep were born on the farm and reared with their ewes until stopping breastfeeding about 90 days of age when they were raised alone. Sheep were allowed access to drinking water and salt blocks throughout the experiment. After 90 days of experimental feeding, all animals fasted for 12 hours and then were transported to a commercial slaughterhouse, where they were immediately slaughtered according to standard commercial ‘halal’ procedures by professional personnel (Abdullah et al., 2019).

Blood collection and analysis

On the last day of the experiment, all sheep were subjected to venous blood collection using a 10 mL vacuum blood collection tube containing anticoagulant in the morning. Blood collected was separated by centrifugation at 4°C at 3,200×g for 15 min, and serum was stored at –20°C for determination of TG, total cholesterol (TC), FFAs, high-density lipoprotein (HDL), and low-density lipoprotein (LDL; Childs et al., 2008). Serum indicators were detected using the Hitachi-3110 fully automated biochemistry analyzer.

Carcass characteristics measurements and sample collection

The initial and final weight (the weight of the sheep at the end of the experiment) of the sheep were recorded to evaluate the average daily gain. The daily feed intake of each sheep was recorded to evaluate the average daily feed intake. After slaughter, the carcass weight of each sheep was used to calculate the dressing percentage of the animals. After carcass segmentation, the characteristics of the relevant carcasses were measured, including the thickness of the back fat at the 12th rib, and the area of the longissimus thoracis (LT) muscle between the 12th and 13th ribs on the left side. The bones were separated from the muscle and fat tissues and weighed to calculate the net weight of meat and carcass yield.

Approximately 5 g of the LT muscle sample was placed in sterile tubes, frozen in liquid nitrogen, and stored at –80°C for further analysis. In addition, the remaining sample of LT muscle was placed in a polyethylene sample bag and stored at –20°C until the analysis of IMF, TG, and the composition of fatty acid.

Intramuscular fat (IMF), triglycerides (TG), and fatty acid composition

The IMF content in the LT muscle was detected by the Soxhlet petroleum-ether extraction method based on the Chinese National Standards GB/T 5009.6.2016. The IMF contents in LT muscle were detected by the Soxhlet petroleum-ether extraction method based on Chinese National Standards GB/T 5009.6.2016. Homogenized tissue samples were prepared in physiological saline solution (tissue weight: physiological saline solution=1:9), centrifuged for 10 minutes, and the TG content was determined using the GPO-PAP method reagent kit (A110-1-1 triglyceride assay kit, Nanjing Jiancheng Bioengineering Institute, Nanjing, China).

The composition and contents of fatty acids were detected in the way described by Folch et al. (1957). Samples of fatty acids were extracted from 5 g of meat using chloroform: methanol (2:1, v/v), filtered, and mixed with 20% sodium chloride, after shaking and standing, the chloroform lipid fraction was retained. After rotary evaporation, the lipid extracts were saponified and methylated. The upper solution was absorbed into the injection bottle and ready for gas chromatography analysis. Gas chromatography (Agilent/GC8860, Agilent, Santa Clara, CA, USA), flame ionization detector, automatic sample injection, and capillary column were used for detection. The initial temperature setting of the column oven is 120°C, kept for 5 min, then increased to 250°C at a rate of 10°C/min and maintained for 28 min. The carrier gas used is nitrogen. The fatty acid analysis was performed with a split ratio of 1:20, constant flow mode, with an average speed of 28 cm/s. The relative proportions of fatty acids were identified by comparing the peak areas with the reference standard 37-component FAME mix from Supelco Analytical (Sigma-Aldrich, Darmstadt, Germany).

RNA extraction and real-time quantitative analysis

Total ribonucleic acid was extracted from LT muscle samples using the RNAiso Plus reagent (No. 9109, Takara, Kusatsu, Japan). Reverse transcription was performed using the PrimeScriptTM RT reagent kit (No. RR047, Takara). The Roche LightCycler 96 QPCR system and TB GreenTM Premix Ex TaqTMII (No. RR820A, Takara) were used for real-time PCR. The β-actin gene was used as a reference gene. The PCR data analysis program was used to quantify the Ct values, and the mRNA expressions were calculated using the 2-ΔΔCt method. The primers for quantitative real-time PCR are shown in Table 2.

Table 2. Primer sequence for cloning and quantitative RNA assay
Gene name GenBanK Primer sequence (5′–3′) Product size (bp)
β-actin NM_001009784.3 F:CTCACGGAGCGTGGCTACA 107
R:GCCATCTCCTGCTCGAGGTC
AMPKα2 XM_042245133.1 F:ATGAGGTGGTGGAGCAGAGAAG 131
R:CGTGAGAGAGCCAGAGAGTGAA
ACCα XM_027973952.1 F:GACACATCACATCCGTCCTCT 188
R:GTCCATCACCACAGCCTTCAT
CPT1B XM_027965744.1 F:TGTTCAACACCACTCGCATC 116
R:CTCGTAGAGCCACAGCTTGA
SREBP-1c XM_027974786.1 F:CGCAAAGCCATCGACTACATC 52
R:TGAGCTTCTGGTTGCTGTGCT
FASN XM_027974304.1 F:GTGTGGTACAGCCCCTCAAG 110
R:ACGCACCTGAATGACCACTT
SCD1 NM_001009254.1 F:GAGTACCGCTGGCACATCAA 103
R:CTAAGACGGCAGCCTTGGAT

β-actin, actin beta; AMPKα2, adenosine 5’-monophosphate-activated protein kinase alpha 2; ACCα, acetyl-CoA carboxylase alpha; CPT1B, carnitine palmitoyltransferase 1B; SREBP-1c, sterol regulatory element binding protein 1c; FASN, fatty acid synthase; SCD1, stearoyl-CoA desaturase 1.

Download Excel Table
Determination of the key enzyme activity

Following the homogenization of the longissimus dorsi muscle tissue, the supernatant was collected, and the activity of p-AMPKα2, p-ACCα, CPT1B, SREBP-1c, FASN and SCD1 in the LT muscle tissue was measured using ELISA kits from Wuhan Xinqidi Biological Technology (Wuhan, China). The experimental procedures were conducted according to the instructions provided with the kits.

Statistical analysis

Using IBM SPSS Statistics 22.0 to perform normality tests on the data, independent sample t-test analysis is used to analyze differences in group statistics. Partial least squares discriminant analysis (PLS-DA) was used to identify the main factors that affect the composition of the fatty acids. Data are presented as the mean±SEM. Extremely significant was defined as p<0.01, significance was defined as p<0.05, and trends were defined as 0.05≤p<0.10.

Results

Growth and slaughter performance

As shown in Table 3, the loin eye area (LEA) of the LT muscle in the PRO was significantly higher than that of the CON (p<0.05). Compared to CON, PRO also showed an increasing trend in final weight and carcass weight, while carcass length showed a decreasing trend (0.05≤p<0.10). There were no significant differences in other traits of growth and slaughter performance (p>0.05).

Table 3. Effects of probiotic feed on growth and slaughter performance of Sunit sheep
Item Treatment1) SEM p-value
CON POR
Initial weight (kg) 17.65 18.12 1.88 0.814
Final weight (kg) 31.77 33.33 2.05 0.082
ADG (kg/d) 0.16 0.15 0.01 0.715
ADFI (kg/d) 1.64 1.59 0.06 0.860
Carcass weight (kg) 14.73 15.40 1.60 0.084
Dressing percentage (%) 45.95 46.58 0.01 0.287
Carcass length (cm) 73.80 70.00 1.73 0.065
Net meat weight (kg) 12.04 12.51 1.16 0.665
Carcass yield (%) 80.62 81.20 0.78 0.499
Back fat thickness (mm) 4.93 4.03 0.58 0.173
Loin eye area (cm2) 14.00a 16.25b 0.85 0.038

1) CON, basic diet; POR, basic diet+1% probiotic.

a,b Within a row, values with different superscripts differ significantly at p<0.05 or p<0.01. Data are expressed as means±SEM.

ADG, average daily gain; ADFI, average daily feed intake.

Download Excel Table
Plasma lipid biochemical indicators

From Table 4, it can be concluded that the PRO showed significant decreases in plasma levels of TG, HDL, LDL, and FFA compared to the CON (p<0.01). On the contrary, there were no significant differences in TC levels between CON and PRO (p>0.05).

Table 4. Effects of probiotic feed on plasma lipid biochemical indicators of Sunit sheep
Item Treatment1) SEM p-value
CON POR
TG (mmol/L) 3.59a 1.72b 0.08 <0.001
TC (mmol/L) 7.23 7.70 0.47 0.333
HDL (mmol/L) 1.52a 0.91b 0.03 <0.001
LDL (mmol/L) 0.27a 0.06b 0.13 <0.001
FFA (mmol/L) 1.09a 0.86b 0.04 <0.001

1) CON, basic diet; POR, basic diet+1% probiotic.

a,b Within a row, values with different superscripts differ significantly at p<0.05 or p<0.01. Data are expressed as means±SEM.

TG, triglycerides; TC, total cholesterol; HDL, high-density lipoprotein; LDL, low-density lipoprotein; FFA, free fatty acids.

Download Excel Table
Intramuscular fat (IMF) content and triglyceride (TG) content

The effect of probiotics feed on IMF and TG levels in Sunit sheep is reflected in Table 5. It can be seen that compared to the CON, the PRO showed a significant increase in IMF content (p<0.05). It should be noted that the significant trend in TG and IMF is the same (p<0.01).

Table 5. Effect of probiotics feed on intramuscular fat content and triglyceride content of the LT of Sunit sheep
Item Treatment1) SEM p-value
CON POR
IMF (g/100 g) 0.46b 0.57a 0.04 0.024
TG (mmol/g prot) 2.98b 3.74a 0.25 0.006

1) CON, basic diet; POR, basic diet+1% probiotic.

a,b Within a row, values with different superscripts differ significantly at p<0.05 or p<0.01. Data are expressed as means±SEM.

LT, longissimus thoracis; IMF, intramuscular fat; TG, triglycerides.

Download Excel Table
Fatty acid profiles

The probiotics feed to a certain extent ameliorated the fatty acid profiles in the LT of the Sunit sheep, as shown in Fig. 1 and Table 6. Compared to the CON, the proportion of MUFA and n-3 PUFAs in the PRO increased significantly (p<0.05). Further analysis found that probiotics supplementation with feed significantly decreased the proportion of capric acid (C10:0) and (C14:0; p<0.05), greatly increased the percentage of myristoleic acid (C14:1; p<0.01), and dramatically raised the proportion of oleic acid (C18:1n9 cis; p<0.05). At the same time, the effect of probiotics on the profile of PUFAs was more pronounced, with a substantial increase in the proportion of arachidonic acid (C20:4n6; p<0.01), and a considerable increase in the percentage of γ-linolenic acid (C18:3n6), α-linolenic acid (C18:3n3), cis-8,11,14-eicosatrienoic acid (C20:3n6), cis-5,8,11,14,17-eicosapentaenoic acid (EPA, C20:5n3) and cis-15-tetracosenoic acid (C24:1n3; p<0.05), while the proportion of linoleic acid (C18:2n6) showed slowly increasing trend (0.05≤p<0.10).

kosfa-43-5-805-g1
Fig. 1. Effects of probiotics on composition of the fatty acids in the LT of Sunit sheep. (A) Saturated fatty acid; (B) monounsaturated fatty acid; (C) polyunsaturated fatty acid and C24:1 n-3; (D) total fatty acid. CON, basic diet; POR, basic diet+1% probiotic. * p<0.05, ** p<0.01. LT, longissimus thoracis.
Download Original Figure
Table 6. Effects of probiotics feed on the fatty acid profiles of Sunit sheep
Items Treatment1) SEM p-value
CON PRO
C10:0 0.11a 0.08b 0.02 0.048
C12:0 0.11 0.10 0.01 0.253
C14:0 2.13a 1.67b 0.17 0.020
C16:0 22.79 22.62 0.22 0.872
C18:0 15.36 15.26 0.39 0.798
C20:0 0.14 0.16 0.02 0.256
SFA2) 40.64 39.89 0.24 0.112
C14:1 0.47b 1.01a 0.09 <0.001
C16:1 2.56a 1.89b 0.16 0.010
C18:1n9 cis 44.22b 45.61a 0.54 0.026
C24:1n3 0.12b 0.16a 0.02 0.007
MUFA3) 47.36b 48.67a 0.27 0.035
C18:2n6 7.32 8.74 0.69 0.097
C18:3n6 0.24b 0.46a 0.05 0.002
C18:3n3 0.45b 0.57a 0.05 0.036
C20:3n6 0.13b 0.38a 0.06 0.041
C20:4n6 0.21b 0.40a 0.02 <0.001
C20:5n3 0.38b 0.48a 0.04 0.017
PUFA4) 8.37 11.03 0.47 0.091
n-3 PUFA5) 0.95b 1.21a 0.03 0.012
n-6 PUFA6) 7.90b 9.98a 0.32 0.025

1) CON, basic diet; POR, basic diet +1% probiotic.

2) C10:0+C12:0+C14:0+C16:0+C18:0+C20:0.

3) C14:1+C16:1+C18:1n9 cis+C24:1n3.

4) C18:2n6+C18:3n6+C18:3n3+C20:3n6+C20:4n6+C20:5n3.

5) C24:1n3+C18:3n3+C20:5n3.

6) C18:2n6+C18:3n6+C20:3n6+C20:4n6.

a,b Within a row, values with different superscripts differ significantly at p<0.05 or p<0.01. Data are expressed as means±SEM.

SFA, saturated fatty acid; MUFA, monounsaturated fatty acid; PUFA, polyunsaturated fatty acid.

Download Excel Table
Specific description of fatty acids composition

In this study, PLS-DA was applied to elucidate the clustering and overall differences among different groups of fatty acids. There was some overlap between the CON and the PRO groups of fatty acids, but not complete consistency. The scores of the first two factors of PLS-DA are shown in (Fig. 2A). The first principal component factor (PC1) explained 35.7% of the variance, and the second principal component factor (PC2) explained 21.5% of the variance. Based on the PLS-DA loading plot shown in (Fig. 2B), C16:1, C14:1, C24:1n3, 8,11,14-eicosatrienoic acid (C20:3n6), C18:3n-3, and C18:2n6 had higher loading coefficients on PC1, indicating a strong association with PC1. At the same time, C14:1, C24:1n3, and C20:3n6 showed a positive correlation with PC1, while C16:1, C18:3n-3, and C18:2n6 showed a negative correlation with PC1. Meanwhile, PC2 had a close relationship with C18:1n9 cis, arachidic acid (C20:0), C18:3n6, lauric acid (C12:0), C14:0, and hexadacanoic acid (C16:0), among which only C18:1n9 cis showed a negative correlation with PC2, while the other indicators showed a positive correlation with PC2. It is worth noting that PC1 mainly described unsaturated fatty acids (UFAs), while PC2 was described by both saturated fatty acids (SFAs) and UFAs.

kosfa-43-5-805-g2
Fig. 2. PLS-DA model plot of fatty acid composition. (A) is a Scatter plot with the horizontal and vertical axes representing the contribution rates of principal component 1 (PC1) and principal component 2 (PC2), respectively. The origin and squares represent sample points from the CON and the PRO, respectively. (B) is a loading plot with the horizontal and vertical axes representing the coefficients of the linear combination of PC1 and PC2. CON, basic diet; POR, basic diet+1% probiotic. PLS-DA, partial least squares discriminant analysis.
Download Original Figure
The levels of mRNA expression of genes related to lipid metabolism

The levels of mRNA expression of genes associated with fatty acid metabolism, including the synthesis and oxidation of fatty acid, are shown in Fig. 3. The expression of AMPKα2 mRNA, a key transcription factor involved in energy metabolism, was significantly lower in the PRO compared to the CON (p<0.05), while the expression of SREBP-1c mRNA, a key transcription factor involved in lipid metabolism, was significantly higher in the PRO (p<0.01). Furthermore, compared to the CON, the addition of probiotics feed significantly upregulated the expression of ACCα mRNA, an intermediate metabolite that plays an important role in fatty acids synthesis and metabolism (p<0.01). Conversely, the expression of CPT1B mRNA, a rate-limiting enzyme in the oxidation of fatty acids, was significantly downregulated by probiotics feed (p<0.01). Similarly, the expression of FASN mRNA, a fatty acid synthesis enzyme, was significantly upregulated in the PRO (p<0.05). Moreover, the expression of stearoyl-CoA desaturase 1 (SCD1) mRNA, the enzyme responsible for desaturating SFAs into MUFAs, was also significantly upregulated in the PRO (p<0.01).

kosfa-43-5-805-g3
Fig. 3. Effects of probiotics feed on the relative expression of mRNA of lipid metabolism genes from Sunit sheep. (A, B, C, D, E, and F) represents the relative of AMPKα2, ACCα, CPT1B, SREBP-1c, FASN, and SCD1 in the CON group and the PRO group, respectively. (G) represents the value of Log 2 fold change for each gene. CON, basic diet; POR, basic diet+1% probiotic. * p< 0.05, ** p<0.01. AMPKα2, adenosine 5’-monophosphate-activated protein kinase alpha 2; ACCα, acetyl-CoA carboxylase alpha; CPT1B, carnitine palmitoyltransferase 1B; SREBP-1c, sterol regulatory element binding protein-1c; FASN, fatty acid synthase; SCD1, stearoyl-CoA desaturase 1.
Download Original Figure
The activity of key enzymes involved in lipid metabolism

The impact of probiotics feed on the key molecular activity of enzymes related to lipid metabolism in Sunit sheep is illustrated in Fig. 4. Based on the figure, it can be observed that the activity of p-AMPKα2 and CPT1B in the PRO was significantly reduced compared to the CON (p<0.05), whereas the activities of p-ACCα, SREBP-1c, FASN, and SCD1 were significantly increased (p<0.01). These findings demonstrate a similar trend to the mRNA expression results mentioned earlier.

kosfa-43-5-805-g4
Fig. 4. Effect of probiotics feeds on the activity of enzymatic of key molecules of lipid metabolism in Sunit sheep. (A, B, C, D, E, and F) represents the activity of enzymatic of AMPKα2, ACCα, CPT1B, SREBP-1c, FASN, and SCD1 in the CON group and the PRO group, respectively. CON, basic diet; POR, basic diet+1% probiotic. * p< 0.05, ** p<0.01. AMPKα2, adenosine 5’-monophosphate-activated protein kinase alpha 2; ACCα, acetyl-CoA carboxylase alpha; CPT1B, carnitine palmitoyltransferase 1B; SREBP-1c, sterol regulatory element binding protein-1c; FASN, fatty acid synthase; SCD1, stearoyl-CoA desaturase 1.
Download Original Figure
Correlation between lipid composition parameters and gene expression

Pearson’s correlation analysis was conducted to determine the correlation between lipid composition parameters and gene expression. As shown in Table 7, AMPKα2 showed significant negative correlations with IMF, C14:1, C18:3n6, C20:3n6, and C20:4n6, while ACCα exhibited significant positive correlations with C14:1, C18:2n6, C18:3n6, C20:3n6, C20:4n6, and C24:1n3. CPT1B showed significant negative correlations with C14:1, C18:2n6, C18:3n6, C20:3n6, C20:4n6, and C24:1n3. Additionally, SREBP-1c exhibited significant positive correlations with C14:1, C20:3n6, and C20:4n6. As predicted, FASN showed a strong positive correlation with IMF, while SCD1 demonstrated a significant negative correlation with C10:0, and significant positive correlations with C18:3n6, C20:3n6, and C20:4n6.

Table 7. Correlation between lipid composition parameters and gene expression of Sunit sheep
Item Pearsonr
AMPKα2 ACCα CPT1B SREBP-1c FASN SCD1
IMF –0.585* 0.256 –0.429 0.437 0.734** 0.111
TG –0.233 –0.032 –0.200 0.035 0.217 0.465
C10:0 0.558* –0.434 0.538* –0.329 0.090 –0.509*
C12:0 0.307 0.050 0.151 0.095 0.118 0.145
C14:0 0.286 –0.216 0.332 –0.118 –0.077 –0.007
C16:0 –0.097 0.459 –0.320 0.344 0.068 0.066
C18:0 0.029 –0.095 0.015 –0.170 0.115 –0.361
C20:0 0.062 0.449 –0.195 0.195 0.280 0.377
C14:1 –0.536* 0.706** –0.633** 0.550** –0.130 0.479
C16:1 0.556* –0.730** 0.718** –0.454 –0.052 –0.408
C18:1cis-9 0.487* –0.603* 0.563* 0.260 0.127 –0.386
C18:2n6 –0.384 0.635** –0.559* 0.213 –0.227 0.362
C18:3n6 –0.493* 0.701** –0.578* 0.410 –0.185 0.544*
C18:3n3 –0.268 0.349 –0.367 0.092 –0.069 0.437
C20:3n6 –0.662** 0.799** –0.790** 0.599** –0.058 0.534*
C20:4n6 –0.656** 0.810** –0.797** 0.572** –0.105 0.539*
C20:5n3 –0.157 0.169 –0.096 0.077 –0.108 0.205
C24:1n3 –0.384 0.530* –0.502* 0.283 0.038 0.247

*,** Indicated the significance of the correlations.

AMPKα2, adenosine 5’-monophosphate-activated protein kinase alpha 2; ACCα, acetyl-CoA carboxylase alpha; CPT1B, carnitine palmitoyltransferase 1B; SREBP-1c, sterol regulatory element binding protein-1c; FASN, fatty acid synthase; SCD1, stearoyl-CoA desaturase 1; IMF, intramuscular fat; TG, triglycerides.

Download Excel Table

Discussion

The nutritional and dietary value of sheep is largely determined by its feed, which also affects consumer health by influencing the IMF content and the composition of fatty acids. Probiotics, as beneficial feed additives, are widely used in livestock production. Therefore, it is necessary to evaluate the effects of probiotics feed on growth performance, carcass characteristics, plasma biochemical parameters, and muscle lipid indicators, including IMF and TG content, fatty acid composition, and the expression of the lipid-related genes and the activity of the enzyme of sheep, in order to provide reasonable recommendations for intensive livestock production.

The present study revealed that probiotics supplementation in Sunit sheep resulted in an increasing trend in final weight and carcass weight, along with a significant improvement in the LEA, which is consistent with previous research findings (Lu et al., 2021). LEA, as a growth indicator, is highly positively correlated with meat production performance and lean meat percentage and is an important indicator for evaluating the carcass quality of domestic animals. The larger area of the loin eye and the potential higher fat content in the LT may positively influence the taste of the meat. It is noteworthy that the results of this study confirm the higher IMF content in the LT of Sunit sheep in the PRO, supporting the aforementioned interpretation. Similar observations have been made by Nie et al. and Ramzi et al., who reported that adding probiotics to the diet can increase IMF levels in mutton and alter the overall fat distribution in sheep, which is in line with our research results (Amran et al., 2021; Nie et al., 2022). The most plausible explanation for these findings is that probiotics modulate rumen fermentation patterns and alter indicators of lipid metabolism, including the composition of fatty acids, further promoting the synthesis and distribution of IMF. Therefore, it was necessary to explore the differences in the plasma biochemical indicators of sheep influenced by probiotics.

The results of this study on the effects of probiotics feed on plasma lipid biochemical indicators in Sunit sheep are consistent with the findings of Abas, Chiofalo, and Baiomy, who reported that probiotics supplementation can decrease the concentrations of plasma TG and LDL in lambs (Abas et al., 2007; Baiomy, 2010; Chiofalo et al., 2004). The reduction of plasma TG may be attributed to the improved digestive and absorptive functions of ruminant animals by probiotics feed, which can reduce the absorption and synthesis of fats in the intestine, thereby lowering the synthesis and accumulation of plasma TG (Sheikh et al., 2019). The current research findings on the impact of probiotics on cholesterol metabolism in sheep plasma are inconclusive. The research conducted by Mahesh and Jia suggests that probiotics can influence cholesterol metabolism through various metabolic pathways, such as reducing cholesterol absorption and inhibiting the activity of cholesterol synthesis enzymes (Jia et al., 2022; Mahesh et al., 2020). This leads to a decrease in the levels of LDL in the plasma, which has a positive effect on plasma cholesterol metabolism. In this study, the addition of probiotics didn’t significantly alter the levels of TC in the serum of Sunit sheep, but it did reduce the concentration of LDL in the plasma. This suggests that different types of probiotics may have varying effects on cholesterol metabolism in sheep. Therefore, more research is needed to elucidate the specific mechanisms by which probiotics regulate cholesterol lipoprotein levels in sheep plasma. In this study, the PRO showed a reduction in the levels of FFA in the plasma of Sunit sheep. Probiotics were able to decrease the rate of release of FFA, regulate fatty acid metabolism in plasma, and ultimately affect fat metabolism in muscle tissue. The decrease in FFA levels in plasma may lead to a reduction in fatty acid oxidation in muscle tissue. Fatty acid oxidation is the process by which fatty acids are converted into energy within cells. When fatty acid oxidation is reduced, muscle tissue can tend to store fatty acids as fat (Domaradzki et al., 2019; Roque-Jiménez et al., 2021). This could be a possible reason for the increase in IMF content in the muscle of feed with probiotics, as observed by Mackey, who found that supplementation of probiotics components to cattle in feed resulted in an increased marbling score in LT, indicating that probiotics may enhance IMF deposition in cattle (Mackey et al., 2023).

In meat, IMF is abundant in fatty acids, which can be absorbed by the human body and enter the bloodstream for transportation to various tissues. Changes in IMF content and TG levels in meat lead to corresponding alterations in the relative content of fatty acids. Increasing the IMF content is associated with a decrease in the concentration of PUFAs in meat, while the concentration of SFAs and MUFAs increases (Lukic et al., 2019; Purchas et al., 2005; Razmaitė et al., 2020; Realini et al., 2021). Joo suggests that the C18:1n9 cis levels in beef increase with the marbling pattern, and this elevation of C18:1n9 cis content is beneficial to the human body (Joo et al., 2017). Kazala indicates that the relative content of C14:0 in beef cattle increases with the increase in total lipids and TG. Meanwhile, the relative content of C18:3 in beef is negatively correlated with the total lipid content (Kazala et al., 1999). In this study, the model of PLS-DA was constructed. PC1 was defined as describing UFAs, while PC2 was defined as being able to simultaneously describe both SFAs and UFAs. The variable loadings plot showed that the fatty acids that contribute significantly to PC1 and PC2 were positively correlated in their relative positions in the two-dimensional space, mainly concentrated along the positive axes of PC1 and PC2.

As stated above, the addition of probiotics to the feed has been found to increase the IMF content in Sunit sheep. Furthermore, it has been observed that the use of probiotic feed has led to an increasing trend in the relative proportion of UFAs in the LT of Sunit sheep. Specifically, the proportions of C14:1 and C18:1n9 cis were significantly increased in the PRO. Among them, C18:1n9 cis is the most abundant UFA, which is considered to be positively correlated with the tenderness of fat and the sensory quality of meat. The higher C18:1n9 cis content can enhance the palatability of the meat (Tang et al., 2021). Furthermore, probiotics can modulate the synthesis and oxidation of MUFAs by regulating metabolic enzymes such as fatty acyl-CoA synthetase and enzymes limiting the rate of fatty acid oxidation, thereby altering the composition of UFAs in meat (Gheorghe et al., 2022). In accordance with the findings mentioned earlier, an increase in the relative proportion of MUFAs may result in a decrease in LDL levels in the body. In this study, the relative proportions of C18:3n6, C18:3n3, C20:3n6, C20:4n6, C20:5n3, C24:1n-3, and n-3 PUFA were found to be higher in the LT of Sunit sheep in the PRO. Among them, C18:3n6 and C18:3n3 are important substrates for the synthesis of long-chain PUFAs of n6 and n3 origin (Ganesh and Hettiarachchy, 2016). C20:4, as an important essential fatty acid, plays a role in changing cell membrane stability and participating in cell-mediated lipid metabolism (Calder, 2008). The content of C20:4 is related to the activity of fatty acid desaturase. The addition of probiotics to the diet benefits the activity of fatty acid desaturase. Generally speaking, higher expression levels of fatty acid desaturase are associated with a higher synthesis rate and content of C20:4 (Dev et al., 2021). The composition and relative proportion of fatty acids in meat are key factors that influence its nutritional value. This study suggests that the addition of probiotics to the diet improves the proportion of PUFAs in the LT of Sunit sheep, indicating that probiotics may have a role in improving the nutritional value of fatty acids in meat.

In order to further elucidate the mechanisms underlying IMF accumulation and fatty acid metabolism, we conducted a comprehensive analysis and assessment of gene expression levels and corresponding enzyme activities involved in the regulation of muscle fat deposition and fatty acid metabolic pathways. As widely acknowledged, the signaling of AMPK serves as a critical sensor of cellular energy, capable of participating in and regulating lipid homeostasis and fatty acid metabolism in muscle, including β-oxidation of fatty acid, synthesis of de novo fatty acid, and transport of fatty acid (Kim et al., 2014; Wang et al., 2013). According to research, AMPK is believed to play a crucial role in the regulation of lipid metabolism by modulating downstream enzymes, ACCα and CPT1B, which are involved in the fatty acid β-oxidation pathways (Ronnett et al., 2006). ACCα, as a central regulator of fatty acid metabolism, catalyzes the production of malonyl-CoA, an inhibitor of CPT1B, thus modulating CPT1B activity and regulating β-oxidation of fatty acid, therefore, the AMPKα2-ACCα-CPT1B signaling pathway plays a crucial role in fat deposition and fatty acid metabolism (Kim et al., 2012). The results of this study revealed that supplementation with probiotic feed inhibited the expression of AMPKα2 mRNA and CPT1 mRNA, while promoting ACCα mRNA expression in the LT of Sunit sheep. This suggests that probiotics feed may inhibit the expression of AMPKα2 signaling factor in Sunit sheep, impeding the AMPKα2-ACCα pathway, inhibiting CPT1B mRNA, and weakening the β-oxidation process of fatty acids, leading to increased fatty acid synthesis. The precise mechanism underlying the modulation of CPT1B mRNA by probiotics and its ultimate regulation of fat deposition in Sunit sheep remains unclear. Some studies have proposed that lactate generated as a result of probiotic administration can promote the generation of acetyl-CoA, which directly inhibits the expression of CPT1B mRNA. Subsequent reactions in this pathway ultimately lead to intracellular lipid accumulation (Araújo et al., 2020; Brooks, 2020).

In addition, the transcription factor SREBP-1c is a key regulatory factor in the synthesis of fatty acids, capable of activating the expression of FASN mRNA, ACCα mRNA, and SCD1 mRNA, while its expression is also controlled by AMPK. Consistent with ACCα, the activity of SREBP-1c is negatively regulated by AMPK. Research has shown that AMPK inhibits the expression of SREBP-1c mRNA, thereby reducing the expression of FASN mRNA and subsequently inhibiting lipogenesis (An et al., 2019; Deng et al., 2015). SCD1, a crucial factor expressed in adipose tissue, is a target gene for SREBP-1c and plays a selective role in the regulation of de novo lipogenesis and fatty acid conversion, mediating adipogenesis and fatty acid metabolism. Deficiency of SCD in sheep is associated with decreased TG levels, as well as reduced expression of SREBP-1c mRNA and FASN mRNA (He et al., 2021; Liu et al., 2020; Tian et al., 2018). In this study, probiotics were found to inhibit the expression of AMPKα2 mRNA while promoting the expression of SREBP-1c mRNA and FASN mRNA, which may result in a tendency to fat synthesis in LT, leading to IMF deposition. Furthermore, probiotics significantly increased SCD mRNA expression, indicating that probiotics have the ability to gradually convert SFAs to UFAs, which may be one of the reasons why the probiotic group had a relatively higher proportion of UFAs as mentioned earlier (Tian et al., 2021).

Further research unveiled a similarity between the enzyme activity outcomes and the mRNA expression level findings. The results indicate that probiotics feed can regulate the ACCα, CPT1B, SREBP-1c, FASN, and SCD1 by inhibiting the AMPKα2, resulting in enhanced IMF synthesis and reduced oxidation of fatty acids in the LT of Sunit sheep. This ultimately leads to an increase in IMF content and improved fatty acid composition in meat.

The correlation analysis between gene expression and IMF, TG, and fatty acid composition has been used to investigate the relationship between gene signaling pathways and lipid composition parameters. Even minor changes in chemical structure can significantly alter lipid signaling activity, so research on gene-regulated fatty acids composition is limited (Tánori-Lozano et al., 2022). The AMPK signaling factor can regulate the cellular uptake of fatty acids through translocation of fatty acids. Studies suggest that inhibiting AMPKα2 may increase key enzyme activities in the fatty acid synthesis pathway, leading to an increase in PUFAs synthesis, while simultaneously reducing cellular fatty acid β-oxidation, resulting in the accumulation of fatty acids (Dzamko et al., 2008; Kohan et al., 2009). In addition, downstream genes of the AMPK signaling pathway, including ACCα, CPT1B, SREBP-1c, FASN, and SCD1, are closely associated with the composition of fatty acids. Studies suggest that elevated expression of ACCα mRNA promotes the deposition of UFAs, and the accumulation of UFAs inhibits the expression of CPT1B mRNA (Zhu et al., 2022). Meanwhile, the main function of SREBP-1c is to promote the synthesis of fatty acids and TG, exerting a positive regulatory effect on adipose deposition and fatty acid metabolism (Guo et al., 2023). In this study, the expression levels of AMPKα2 mRNA and CPT1B mRNA were negatively correlated with IMF, C18:3n6, C20:3n6, and C20:4n6, while the expression levels of ACCα mRNA were positively correlated with their contents. Furthermore, it was further confirmed that inhibition of the AMPKα2 signaling pathway could promote IMF deposition in Sunit sheep by enhancing ACCα and SREBP-1c factors and improving the composition of fatty acids (Fig. 5).

kosfa-43-5-805-g5
Fig. 5. Possible pathways by which probiotics feed affect the AMPK signaling pathway to promote IMF deposition and improve fatty acid composition. AMPKα2, adenosine 5’-monophosphate-activated protein kinase alpha 2; ACCα, acetyl-CoA carboxylase alpha; SREBP-1c, sterol regulatory element binding protein-1c; CPT1B, carnitine palmitoyltransferase 1B; FASN, fatty acid synthase; SCD1, stearoyl-CoA desaturase 1; IMF, intramuscular fat.
Download Original Figure

Conclusion

In conclusion, the results of this study indicate that the addition of probiotics to the diet can regulate fat deposition and improve fatty acid composition in the LT of Sunit sheep through the signaling pathways AMPK-ACC-CPT1 and AMPK-SREBP-1c. This regulatory mechanism leads to an increase in the LEA in Sunit sheep, improved growth performance, and altered plasma lipid biochemical indicators. The findings of this experiment highlight the regulatory effects of probiotics added to the diet on fat deposition and fatty acid composition in the LT of Sunit sheep and provide new insights into the nutritional interactions of ruminant animals mediated by the AMPK pathway. The research results contribute to a better understanding of the potential application of probiotics and provide new insights into the future of food science and animal resources.

Conflicts of Interest

The authors declare no potential conflicts of interest.

Acknowledgements

This work was supported by the National Natural Science Foundation of China (32160589); the Major Science and Technology Projects of Ordos (2022EEDSKJZDZX029); the Major R&D and Achievements Transformation Projects of Inner Mongolia (2022YFXZ0017); the Natural Science Foundation of Inner Mongolia (2020ZD11); the Natural Science Foundation of Inner Mongolia (2022MS03055); the Natural Science Foundation of Inner Mongolia (2021MS03010) and the Scientific Research Projects of Universities Directly under Inner Mongolia (BR22-13-08).

Author Contributions

Conceptualization: Zhang Y, Jin Y. Data curation: Zhang Y, Yao D. Formal analysis: Huang H, Zhang M. Methodology: Zhang Y, Sun L, Su L. Software: Zhang Y. Validation: Zhao L, Guo Y, Jin Y. Investigation: Zhang Y, Yao D, Huang H. Writing - original draft: Zhang Y. Writing - review & editing: Zhang Y, Yao D, Huang H, Zhang M, Sun L, Su L, Zhao L, Guo Y, Jin Y.

Ethics Approval

The study was conducted in accordance with the Declaration of Helsinki, and all animals handling procedures were performed in accordance with the Ethics Committee of Inner Mongolia Agricultural University (permit number: NND2021072).

References

1.

Abas I, Kutay HC, Kahraman R, Toker NY, Ozcelik D, Ates F, Kacakci A. 2007; Effects of organic acid and bacterial direct-feed microbial on fattening performance of Kivircik-Male yearling lambs. Pak J Nutr. 6:149-154

2.

Abdullah FAA, Borilova G, Steinhauserova I. 2019; Halal criteria versus conventional slaughter technology. Animals. 9:530

3.

Amran RA, Alhimaidi AR, Al-Ghadi MQ, Ammari AA, Gaafar ARZ. 2021; Carryover effect of direct-fed microbial supplementation and early weaning on the growth performance and carcass characteristics of growing Najdi lambs. Open Chem. 19:1265-1278

4.

An JP, Choi JH, Huh J, Lee HJ, Han S, Noh JR, Kim YH, Lee CH, Oh WK. 2019; Anti-hepatic steatosis activity of Sicyos angulatus extract in high-fat diet-fed mice and chemical profiling study using UHPLC-qTOF-MS/MS spectrometry. Phytomedicine. 63:152999

5.

Araújo JR, Tazi A, Burlen-Defranoux O, Vichier-Guerre S, Nigro G, Licandro H, Demignot S, Sansonetti PJ. 2020; Fermentation products of commensal bacteria alter enterocyte lipid metabolism. Cell Host Microbe. 27:358-375

6.

Ayala-Monter MA, Hernández-Sánchez D, González-Muñoz S, Pinto-Ruiz R, Martínez-Aispuro JA, Torres-Salado N, Herrera-Pérez J, Gloria-Trujillo A. 2019; Growth performance and health of nursing lambs supplemented with inulin and Lactobacillus casei. Asian-Australas J Anim Sci. 32:1137-1144

7.

Baiomy AA. 2010; Influence of live yeast culture on milk production, composition and some blood metabolites of Ossimi ewes during the milking period. J Anim Poult Prod. 1:469-480

8.

Bao Y, Zhang Y, Li H, Liu Y, Wang S, Dong X, Su F, Yao G, Sun T, Zhang H. 2012; In vitro screen of Lactobacillus plantarum as probiotic bacteria and their fermented characteristics in soymilk. Ann Microbiol. 62:1311-1320

9.

Bessa RJB, Alves SP, Santos‐Silva J. 2015; Constraints and potentials for the nutritional modulation of the fatty acid composition of ruminant meat. Eur J Lipid Sci Technol. 117:1325-1344

10.

Brooks GA. 2020; Lactate as a fulcrum of metabolism. Redox Biol. 35:101454

11.

Calder PC. 2008; The relationship between the fatty acid composition of immune cells and their function. Prostaglandins Leukot Essent Fatty Acids. 79:101-108

12.

Chikwanha OC, Vahmani P, Muchenje V, Dugan MER, Mapiye C. 2018; Nutritional enhancement of sheep meat fatty acid profile for human health and wellbeing. Food Res Int. 104:25-38

13.

Childs S, Hennessy AA, Sreenan JM, Wathes DC, Cheng Z, Stanton C, Diskin MG, Kenny DA. 2008; Effect of level of dietary n-3 polyunsaturated fatty acid supplementation on systemic and tissue fatty acid concentrations and on selected reproductive variables in cattle. Theriogenology. 70:595-611

14.

Chiofalo V, Liotta L, Chiofalo B. 2004; Effects of the administration of Lactobacilli on body growth and on the metabolic profile in growing Maltese goat kids. Reprod Nutr Dev. 44:449-457

15.

Deng X, Dong Q, Bridges D, Raghow R, Park EA, Elam MB. 2015; Docosahexaenoic acid inhibits proteolytic processing of sterol regulatory element-binding protein-1c (SREBP-1c) via activation of AMP-activated kinase. Biochim Biophys Acta Mol Cell Biol Lipids. 1851:1521-1529

16.

Dev K, Begum J, Biswas A, Kannoujia J, Mir NA, Sonowal J, Kant R, Narender T. 2021; Dietary Lactobacillus acidophilus and mannan-oligosaccharides alter the lipid metabolism and health indices in broiler chickens. Probiotics Antimicrob Proteins. 13:633-646

17.

Domaradzki P, Florek M, Skałecki P, Litwińczuk A, Kędzierska-Matysek M, Wolanciuk A, Tajchman K. 2019; Fatty acid composition, cholesterol content and lipid oxidation indices of intramuscular fat from skeletal muscles of beaver (Castor fiber L.). Meat Sci. 150:131-140

18.

Dzamko N, Schertzer JD, Ryall JG, Steel R, Lance Macaulay S, Wee S, Chen ZP, Michell BJ, Oakhill JS, Watt MJ. 2008; AMPK-independent pathways regulate skeletal muscle fatty acid oxidation. J Physiol. 586:5819-5831

19.

Fang K, Wu F, Chen G, Dong H, Li J, Zhao Y, Xu L, Zou X, Lu F. 2019; Diosgenin ameliorates palmitic acid-induced lipid accumulation via AMPK/ACC/CPT-1A and SREBP-1c/FAS signaling pathways in LO2 cells. BMC Complement Altern Med. 19:255

20.

Ferré P, Phan F, Foufelle F. 2021; SREBP-1c and lipogenesis in the liver: An update. Biochem J. 478:3723-3739

21.

Folch J, Lees M, Sloane Stanley GH. 1957; A simple method for the isolation and purification of total lipids from animal tissues. J Biol Chem. 226:497-509

22.

Ganesh V, Hettiarachchy NS. 2016; A review: Supplementation of foods with essential fatty acids—can it turn a breeze without further ado_. Crit Rev Food Sci Nutr. 56:1417-1427

23.

Gheorghe A, Habeanu M, Ciurescu G, Lefter NA, Ropota M, Custura I, Tudorache M. 2022; Effects of dietary mixture enriched in polyunsaturated fatty acids and probiotic on performance, biochemical response, breast meat fatty acids, and lipid indices in broiler chickens. Agriculture. 12:1120

24.

Guo R, Chen L, Zhu J, Li J, Ding Q, Chang K, Han Q, Li S. 2023; Monounsaturated fatty acid-enriched olive oil exacerbates chronic alcohol-induced hepatic steatosis and liver injury in C57BL/6J mice. Food Funct. 14:1573-1583

25.

He L, Qin Y, Wang Y, Li D, Chen W, Ye J. 2021; Effects of dietary replacement of fish oil with soybean oil on the growth performance, plasma components, fatty acid composition and lipid metabolism of groupers Epinephelus coioides. Aquac Nutr. 27:1494-1511

26.

Jia B, Zou Y, Han X, Bae JW, Jeon CO. 2022; Gut microbiome-mediated mechanisms for reducing cholesterol levels: Implications for ameliorating cardiovascular disease. Trends Microbiol. 31:76-91

27.

Joo ST, Hwang YH, Frank D. 2017; Characteristics of Hanwoo cattle and health implications of consuming highly marbled Hanwoo beef. Meat Sci. 132:45-51

28.

Juárez M, Lam S, Bohrer BM, Dugan MER, Vahmani P, Aalhus J, Juárez A, López-Campos O, Prieto N, Segura J. 2021; Enhancing the nutritional value of red meat through genetic and feeding strategies. Foods. 10:872

29.

Kazala EC, Lozeman FJ, Mir PS, Laroche A, Bailey DRC, Weselake RJ. 1999; Relationship of fatty acid composition to intramuscular fat content in beef from crossbred Wagyu cattle. J Anim Sci. 77:1717-1725

30.

Ke R, Xu Q, Li C, Luo L, Huang D. 2018; Mechanisms of AMPK in the maintenance of ATP balance during energy metabolism. Cell Biol Int. 42:384-392

31.

Kim JS, Ingale SL, Lee SH, Choi YH, Kim EH, Lee DC, Kim YH, Chae BJ. 2014; Impact of dietary fat sources and feeding level on adipose tissue fatty acids composition and lipid metabolism related gene expression in finisher pigs. Anim Feed Sci Technol. 196:60-67

32.

Kim MK, Kim SH, Yu HS, Park HG, Kang UG, Ahn YM, Kim YS. 2012; The effect of clozapine on the AMPK-ACC-CPT1 pathway in the rat frontal cortex. Int J Neuropsychopharmacol. 15:907-917

33.

Kohan AB, Talukdar I, Walsh CM, Salati LM. 2009; A role for AMPK in the inhibition of glucose-6-phosphate dehydrogenase by polyunsaturated fatty acids. Biochem Biophys Res Commun. 388:117-121

34.

Laliotis GP, Bizelis I, Rogdakis E. 2010; Comparative approach of the de novo fatty acid synthesis (lipogenesis) between ruminant and non ruminant mammalian species: From biochemical level to the main regulatory lipogenic genes. Curr Genomics. 11:168-183

35.

Li H, Liu F, Lu J, Shi J, Guan J, Yan F, Li B, Huo G. 2020; Probiotic mixture of Lactobacillus plantarum strains improves lipid metabolism and gut microbiota structure in high fat diet-fed mice. Front Microbiol. 11:512

36.

Liu L, Wang Y, Liang X, Wu X, Liu J, Yang S, Tao C, Zhang J, Tian J, Zhao J, Wang Y. 2020; Stearoyl-CoA desaturase is essential for porcine adipocyte differentiation. Int J Mol Sci. 21:2446

37.

Lu J, Chen Z, Gao Q, Li P, Wang J, Cai Y, Wang Z, Li D, Li H, Wang F, Zhang Y. 2021; Combined supplementation of probiotics and enzymes improves performance and regulates rumen microbiota in fattening goats. Res Sq. 1:1-26

38.

Lukic M, Trbovic D, Petronijevic R, Djordjevic V, Karan D, Babic Milijasevic J, Petrovic Z. 2019; Chemical composition and fatty acid profile of the longissimus dorsi muscle in Simmental bulls. IOP Conf Ser Earth Environ Sci. 333:012075

39.

Mackey SJ, Cooke RF, Colombo EA, Pickett AT, Batista LFD, Block E, Brandâo AP. 2023; Supplementing pre- and probiotic ingredients to feedlot steers: Effects on health, growth performance, and physiological responses. Animal. 17:100770

40.

Mahesh MS, Mohanta RK, Patra AK. 2020; Probiotics in livestock and poultry nutrition and health. Adv Probiotics Sustain Food. 21:149-179

41.

Nie C, Hu Y, Chen R, Guo B, Li L, Chen H, Chen H, Song X. 2022; Effect of probiotics and Chinese medicine polysaccharides on meat quality, muscle fibre type and intramuscular fat deposition in lambs. Ital J Anim Sci. 21:811-820

42.

Pećina M, Luković Z, Škorput D, Bolčić M, Salajpal K, Karolyi D. 2018; Relationship between intramuscular fat content and fatty acid composition of pork. J Cent Eur Agric. 19:840-845

43.

Purchas RW, Knight TW, Busboom JR. 2005; The effect of production system and age on concentrations of fatty acids in intramuscular fat of the longissimus and triceps brachii muscles of Angus-cross heifers. Meat Sci. 70:597-603

44.

Rabelo CHS, Basso FC, McAllister TA, Lage JF, Gonçalves GS, Lara EC, Oliveira AA, Berchielli TT, Reis RA. 2016; Influence of Lactobacillus buchneri as silage additive and forage: Concentrate ratio on the growth performance, fatty acid profile in longissimus muscle, and meat quality of beef cattle. Can J Anim Sci. 96:550-562

45.

Razmaitė V, Šiukščius A, Šveistienė R, Bliznikas S, Jatkauskienė V. 2020; Relationships between fat and cholesterol contents and fatty acid composition in different meat-producing animal species. Acta Vet. 70:374-385

46.

Realini CE, Pavan E, Purchas RW, Agnew M, Johnson PL, Bermingham EN, Moon CD. 2021; Relationships between intramuscular fat percentage and fatty acid composition in M. longissimus lumborum of pasture-finished lambs in New Zealand. Meat Sci. 181:108618

47.

Ronnett GV, Kleman AM, Kim EK, Landree LE, Tu Y. 2006; Fatty acid metabolism, the central nervous system, and feeding. Obesity. 14:201S-207S

48.

Roque-Jiménez JA, Rosa-Velázquez M, Pinos-Rodríguez JM, Vicente-Martínez JG, Mendoza-Cervantes G, Flores-Primo A, Lee-Rangel HA, Relling AE. 2021; Role of long chain fatty acids in developmental programming in ruminants. Animals. 11:762

49.

Sheikh GG, Masood D, Ganai AM, Muzamil S, Afzal Y, Ahmad HA. 2019; Effect of probiotics mix supplementation on haemato-biochemical parameters and bacterial faecal shedding in Corriedale lambs fed paddy straw based complete feed. Indian J Anim Res. 53:1049-1053

50.

Taboada N, Salom MF, Córdoba A, González SN, Alzogaray SL, Van Nieuwenhove C. 2022; Administration of selected probiotic mixture improves body weight gain and meat fatty acid composition of creole goats. Food Biosci. 49:101836

51.

Tang X, Liu X, Liu H. 2021; Effects of dietary probiotic (Bacillus subtilis) supplementation on carcass traits, meat quality, amino acid, and fatty acid profile of broiler chickens. Front Vet Sci. 8:767802

52.

Tánori-Lozano A, Quintana-Romandía AI, Montalvo-Corral M, Pinelli-Saavedra A, Valenzuela-Melendres M, Dávila-Ramírez JL, Islava-Lagarda TY, González-Ríos H. 2022; Influence of ferulic acid and clinoptilolite supplementation on growth performance, carcass, meat quality, and fatty acid profile of finished lambs. J Anim Sci Technol. 64:274-290

53.

Thomson DM, Winder WW. 2009; AMP-Activated protein kinase control of fat metabolism in skeletal muscle. Acta Physiol. 196:147-154

54.

Tian H, Luo J, Zhang Z, Wu J, Zhang T, Busato S, Huang L, Song N, Bionaz M. 2018; CRISPR/Cas9-mediated stearoyl-CoA desaturase 1 (SCD1) deficiency affects fatty acid metabolism in goat mammary epithelial cells. J Agric Food Chem. 66:10041-10052

55.

Tian Z, Cui Y, Lu H, Wang G, Ma X. 2021; Effect of long-term dietary probiotic Lactobacillus reuteri 1 or antibiotics on meat quality, muscular amino acids and fatty acids in pigs. Meat Sci. 171:108234

56.

Tong X, Li P, Zhang D, VanDommelen K, Gupta N, Rui L, Bishr Omary M, Yin L. 2016; E4BP4 is an insulin-induced stabilizer of nuclear SREBP-1c and promotes SREBP-1c-mediated lipogenesis[S]. J Lipid Res. 57:1219-1230

57.

Toral PG, Monahan FJ, Hervás G, Frutos P, Moloney AP. 2018; Review: Modulating ruminal lipid metabolism to improve the fatty acid composition of meat and milk. Challenges and opportunities. Animal. 12:s272-s281

58.

Wang H, Zhong J, Zhang C, Chai Z, Cao H, Wang J, Zhu J, Wang J, Ji Q. 2020; The whole-transcriptome landscape of muscle and adipose tissues reveals the ceRNA regulation network related to intramuscular fat deposition in yak. BMC Genomics. 21:347

59.

Wang J, Sun H, Guo S, Sun Y, Kwok LY, Zhang H, Peng C. 2021; Comparison of the effects of single probiotic strains Lactobacillus casei Zhang and Bifidobacteriumanimalis ssp. lactis Probio-M8 and their combination on volatile and nonvolatile metabolomic profiles of yogurt. J Dairy Sci. 104:7509-7521

60.

Wang W, Xue W, Jin B, Zhang X, Ma F, Xu X. 2013; Candidate gene expression affects intramuscular fat content and fatty acid composition in pigs. J Appl Genet. 54:113-118

61.

Yang C, Liu J, Wu X, Bao P, Long R, Guo X, Ding X, Yan P. 2017; The response of gene expression associated with lipid metabolism, fat deposition and fatty acid profile in the longissimus dorsi muscle of Gannan yaks to different energy levels of diets. PLOS ONE. 12e0187604

62.

Zhang Z, Liang X, Tong L, Lv Y, Yi H, Gong P, Tian X, Cui Q, Liu T, Zhang L. 2021; Effect of Inonotus obliquus (Fr.) Pilat extract on the regulation of glycolipid metabolism via PI3K/Akt and AMPK/ACC pathways in mice. J Ethnopharmacol. 273:113963

63.

Zhu T, Shen Y, Li X, Pan T, Luo J, Lu J, Bao Y, Wu Z, Jiao L, Tocher DR, Zhou Q, Jin M. 2022; Effects of an alternating linseed oil-fish oil feeding strategy on growth, fatty acid restoration and expression of lipid related genes in black seabream (A. schlegelii). Aquaculture. 547:737456

Announcement


Food Science of Animal Resources will be published by Springer Nature starting in 2026.
Please submit your new paper to Springer Nature website.

https://link.springer.com/journal/44463


I don't want to open this window for a day.